Full opinion text
OPINION McKELVIE, District Judge. This is a patent case. Plaintiff Monsanto Company owns U.S. Patent No. 5,500,-365 (“the ’365 patent”) which is directed to a modified bacterial gene inserted into plants to make plants insect-resistant. The inventors are David A. Fischhoff and Frederick J. Perlak. In a complaint filed in March 1996, Monsanto contends Myco-gen Plant Science, Inc., Agrigenetics, Inc. and Novartis Corporation infringe the ’365 patent. Defendants have answered by denying they infringe the ’365 patent and asserting certain affirmative defenses. Defendants also counterclaim for declaratory judgment of non-infringement, invalidity and unenforceability of the ’365 patent. In June 1998, a jury returned a verdict finding that the defendants’ products literally infringe the ’365 patent, but that the defendants’ products are so far changed from the principle of the invention claimed in the ’365 patent that they do not infringe by application of the reverse doctrine of equivalents. The jury also found that the asserted claims are invalid by prior invention because others invented the claimed subject matter before Monsanto did. The court held a bench trial on defendants’ counterclaim that the ’365 patent is unenforceable because of Monsanto’s alleged inequitable conduct before the Patent and Trademark Office (“PTO”) in prosecuting the application leading to the ’365 patent. The parties have moved for judgment as a matter of law, and Monsanto and Myco-gen have moved for a new trial. The following is the court’s decision on these motions and defendants’ inequitable conduct claim. I. FACTUAL AND PROCEDURAL BACKGROUND A. Status of the Case The court draws the following facts from the evidence presented at the hearing construing the ’365 patent’s claims and at the jury and bench trials. Plaintiff Monsanto Company is a Delaware corporation with its principal place of business in St. Louis, Missouri. Monsanto owns the ’365 patent which is directed to a modified bacterial gene inserted into plants to make plants insect-resistant. Defendant Mycogen Plant Science, Inc. is a Delaware corporation with its principal place of business in San Diego, California. Defendant Agrigenetics, Inc. is a Delaware corporation with its principal place of business in San Diego, California. Agrigenet-ics is a wholly-owned subsidiary of Myco-gen. For convenience, the court refers to Mycogen Plant Science, Inc. and Agrigen-etics, Inc. collectively as “Mycogen.” Defendant Novartis Corporation is a New York corporation with its principal place of business in Summit, New Jersey. Novartis is the product of a merger between Ciba-Geigy Ltd. and Sandoz Ltd. This merger occurred during the course of this litigation. Monsanto originally named Ciba-Geigy Corporation (Seed Division) (“Ciba Seeds”) as a defendant. Ciba Seeds was an unincorporated division of Ciba-Geigy Corporation, (“Ciba-Geigy”) a New York corporation with its principal place of business in Tarrytown, New York. Ciba Seeds had its principal place of business in Research Triangle Park, North Carolina. After the merger took place, the court ordered the case caption changed to reflect that Ciba-Geigy is now known as Novartis. See Monsanto v. Mycogen, D.Del.CA. No. 96-133-RRM, order, McKelvie, J. (June 16, 1998) (D.I.474). The court uses the name Novartis in this opinion for the defendant previously known as Ciba-Geigy. On March 19, 1996, Monsanto filed a complaint contending that defendants infringe and induce others to infringe the ’365 patent. Mycogen and Novartis answered denying the allegations. Mycogen and Novartis asserted the affirmative defense that the ’365 patent is invalid due to prior invention, lack of enablement, lack of written description, indefiniteness and obviousness. Mycogen also asserted the affirmative defense that Mycogen is entitled to a license to practice the teachings of the ’365 patent pursuant to a licensing agreement between Monsanto and Mycogen’s predecessor corporation. Mycogen and Novartis counterclaimed that they have not directly or contribu-torily infringed the ’365 patent, and that the ’365 patent’s claims are invalid for the same reasons stated in their affirmative defenses. In addition, Mycogen counterclaimed that the ’365 patent is unenforceable due to Monsanto’s alleged inequitable conduct before the PTO in prosecuting the application leading to the ’365 patent. Mycogen also counterclaimed that Monsanto misappropriated Mycogen’s trade secrets, breached a confidentiality and non-use agreement between Monsanto and Mycogen’s predecessor, and breached an implied covenant of good faith and fair dealing owed to Mycogen. These last counterclaims arise from Monsanto’s inspection of a patent application owned by Mycogen’s predecessor pursuant to Monsanto’s executing a confidential disclosure and non-use agreement. Mycogen’s predecessor owned this patent application. Mycogen alleges that Monsanto misused proprietary information contained in this application in developing the technology embodied in the ’365 patent. The application at issue has since matured into United States Patent No. 5,380,831 (“the ’831 patent”). Like the ’365 patent, the ’831 patent is directed to a modified bacterial gene inserted into plants to make plants insect-resistant. At the time of trial, My-eogen owned the ’831 patent and Agrigen-etics had the right to produce its commercial embodiment. On February 24, 1997, Monsanto moved for summary judgment on Mycogen’s counterclaims of trade secrets misappropriation, breach of contract, and breach of an implied covenant of good faith and fair dealing, and on Mycogen’s affirmative defense of license. On December 22, 1997, the court granted Monsanto’s summary judgment motion, finding the counterclaims are barred by the statute of limitations, and that Monsanto did not grant Mycogen a license to practice the teachings of the ’365 patent. The court entered an order finding in favor of Monsanto and against Mycogen on these counterclaims and affirmative defense. See Monsanto v. Mycogen, D.Del.C.A. No. 96-133-RRM, order, McKelvie, J. (December 22, 1997) (D.I.292). On May 20,1998, the court held the part of the trial necessary to construe disputed claim language of the ’365 patent, in accordance with Markman v. Westview Instruments, Inc., 517 U.S. 370, 116 S.Ct. 1384, 134 L.Ed.2d 577 (1996). At the conclusion of the claim construction hearing, the court construed the patent claim language at issue. In this opinion, the court explains its claim construction decision in greater detail. From June 15, 1998 to June 30, 1998, the court held a ten-day jury trial on the issues of infringement and validity. On June 30, 1998, the jury returned its verdict. The jury found that defendants’ products literally infringe the four asserted claims (Claims 7, 8, 9 and 12) of the ’365 patent. Although the jury found the defendants’ products literally infringe the asserted claims, the jury also found that defendants’ products are so far changed from the principle of the invention claimed in the ’365 patent that they do not infringe the asserted claims by application of the reverse doctrine of equivalents. The jury also found that the four asserted claims of the ’365 patent are invalid because scientists at Agracetus, Inc. invented the claimed subject matter before Monsanto’s inventors did. On June 29 and July 8, 1998, the court held a bench trial on whether the ’365 patent is unenforceable because of Monsanto’s alleged inequitable conduct before the PTO in prosecuting the application leading to the ’365 patent. As follows, the court decides all pending trial issues and post-trial motions. To better explain the court’s decision on these issues and motions, the court first provides the reader with background on two scientific topics central to this case: (1) Bacillus thuringiensis, a naturally-occurring bacterium, and (2) genetic engineering. B. Background Information on Bacillus Thuringiensis Bacillus thuringiensis (“Bt ”) is a naturally-occurring bacterium found in soil. Bt possesses an unusual property: it produces a protein that kills certain crop-destroying insects. This protein is known variously as “pesticidal protein toxin,” “pesticidal protein,” “toxic crystal protein” or “toxin protein.” When eaten by certain insects, the protein dissolves the insects’ stomach linings, causing the insects to die. While the Bt protein is a natural pesticide, it is not harmful to humans, animals or beneficial insects like bees and ladybugs. The Bt protein is particularly deadly for insects like the European corn borer. This worm-like insect feeds on corn plants, eating its way into stalks and ears. The European corn borer can kill a plant outright or dramatically reduce the size and number of kernels that grow on an ear. According to some estimates, this pest costs American farmers as much as $1 billion per year in lost crops. For years, farmers have been spraying their crops with pesticides containing the Bt protein as well as other chemicals. Spraying, however, is not always effective because some insects, including the European corn borer, tunnel into plants soon after they hatch, or stay on the underside of leaves, where the spray does not reach them. In addition to its ineffectiveness, spraying adds to farmers’ costs and the spraying of some pesticides raises environmental and health concerns. Scientists have long considered the idea of introducing genes from different organisms into crops and livestock. Developments in genetic engineering focused the scientific community’s attention on whether plants could somehow be genetically-modified to resist attack by insect pests. Advances in genetic engineering and plant molecular biology have made it possible to create plants which produce Bt toxin proteins. Thus, these genetically-modified plants have their own built-in protection from insects. Issues related to advances in genetic engineering and plant molecular biology are at the heart of this case. Initially, scientists experimented with inserting the native Bt gene for Bt pesticidal protein into plant cells. The native Bt gene refers to the naturally-occurring gene as it is found in the bacterium. While native Bt genes can be introduced into plant cells, the new genetically-modified plants do not produce enough Bt pesticidal protein to kill insects. In scientific terms, the level of expression of the native Bt genes inserted into the plants is too low to be effective. To solve the problem of low expression, scientists devised ways to increase the level of Bt expression in plants. They eventually succeeded by modifying the native Bt gene, as detailed below. Scientific success led to commercial success. For example, the U.S. Environmental Protection Agency gave its first approval to a genetically-engineered plant to biologically control insects on May 5, 1995, when it approved a genetically-modified potato. By 1996, the EPA approved insect-resistant corn, or Bt corn, for commercial use. In 1996, U.S. farmers planted almost no genetically-modified crops; by 1999, genetically-modified corn accounted for at least one-fourth of the corn grown by U.S. farmers. See Carol Kaesuk Yoon, “Pollen From Genetically Altered Corn Threatens Monarch Butterfly, Study Finds,” New York Times, May 20, 1999 (estimating that in 1999, Bt corn will be cultivated on an estimated 10 million to 20 million acres out of an 80 million acre corn crop nationwide); “Doubling of Land Area Growing Genetically Modified Crops,” Agence France-Presse, Feb. 26, 1998, (estimating that in 1998, genetically-modified corn will be cultivated on eight million hectares [19.75 million acres], chiefly in the United States). See also “Food for Thought,” Economist, Jun. 19, 1999, (estimating that genetically-modified crops account for as much as 55% of U.S. soybean, 50% of U.S. cotton and 40% of U.S. corn production.) The patents at issue involve a method to increase Bt expression in genetically-modified plants. To help the reader understand this method and the issues underlying this case, the court provides the following background information on genetic engineering. C. Background Information on Genetic Engineering Organisms, like plants and animals, are made up of cells. Genes are units of DNA (deoxyribonucleic acid) which encode the necessary information for cells to reproduce and to produce specific proteins. Genes are comprised of DNA, an acronym for deoxyribonucleic acid. DNA consists of two long chains or strands that wrap around each other in a shape known as a double-stranded spiral helix. Visually, a molecule of DNA resembles a twisted ladder. The sides of the ladder are connected by rungs made up of pairs of molecules called nucleotides or bases. Four nucleotides, adenine (“A”), guanine (“G”), cytosine (“C”) and thymine (“T”), form the particular DNA make-up of genes. A particular DNA molecule can be graphically represented by listing the nucleotide sequences making up that DNA molecule. Because of the nucleotides’ chemical make-up, A will only pair with T, and C will only pair with G. This strict complementary pairing means that the order of the nucleotides on one side of a DNA rung determines the order on the other side of the rung. Therefore, each rung of the ladder is composed of one pair consisting of A and T, or C and G. Each rang is called a nucleotide pair, and the order in which these nucleotide pairs appear on the DNA ladder constitutes the genetic code for the cell. DNA directs cells to make proteins through a two-step process of transcription and translation. In the first step, transcription, information is transferred from DNA to an RNA, or ribonucleic acid, molecule. RNA that codes for a protein is called messenger RNA (“mRNA”). RNA is a long single strand of linked nucleotides similar to DNA, except RNA contains the nucleotide Uracil (“U”) in place of Thymine. In transcription, specific nucleotide sequences on the DNA determine where the RNA copy begins and ends. In the second step, translation, the nucleotide sequence of the mRNA is translated into the amino acid sequence of the corresponding protein. For translation, a complex structure known as a ribosome reads the mRNA nucleotide sequence and translates it into amino acids. These amino acids are then assembled into proteins. In this way, ribosomes carry out protein synthesis. Ribosomes read a nucleotide sequence in sets of three nucleotides, known as codons. Each codon directs the ribosome to select a certain amino acid. For example, GCT is a codon directing the ribosome to select the amino acid, alanine. Just as nucleotides are the basic units of DNA, amino acids are the basic units of proteins. A protein can contain few or many amino acids. For example, some Bt pesticidal proteins contain more than 600 amino acids. Thus, a given series of codons specifies a sequence of amino acids comprising a particular protein. While there are 61 possible codons, there are only 20 amino acids. Most amino acids can be specified by more than one codon. In other words, one codon can be substituted for another in the gene without changing the amino acid and resulting protein. For instance, the amino acid, alanine, is specified by four different codons: GCT, GCG, GCC and GCA. Two very different series of codons could produce the exact same series of amino acids. In fact, most amino acids are specified or coded by more than one codon. Scientists use special tables known as codon usage tables to determine the frequency with which certain codons appear in plants and other organisms. For example, Table I of the ’365 patent contains a listing of all 20 amino acids and the various codons which specify these amino acids. The table then compares the frequency with which each codon appears in plants. Similarly, Table V of the ’365 patent contains a listing of the 20 amino acids along with their codon possibilities. The table compares the frequency with which each codon appears in dicot plants and the native Btk gene. (Btk refers to a type or strain of bacterium known as Bacillus thuringiensis var. kurstaki.) Throughout this opinion, reference is made to “dicot” and “monocot” plants. These terms refer to two plant categories. To determine whether a plant is a monocot or dicot, one looks at the plant when it first comes out of the ground. If the plant has only one leaf when it first emerges from the soil, it is a monocot. If the plant has two leaves, it is a dicot. For example, tomato, tobacco and cotton are dicots; corn, barley, rice and wheat are monocots. Knowing that different codons can specify the same amino acid, scientists attempted to solve the problem of low Bt expression in plants by changing the codons in the native Bt gene, without changing the resulting amino acids. Scientists recognized that different organisms prefer certain codons over others for specifying particular amino acids. With this knowledge, they sought to create a Bt gene that would have a codon frequency similar to that of plants, but produce high levels of pesticidal Bt protein. Scientists attempting to increase Bt expression in plants discovered that Bt genes have a higher percentage of A and T nucleotides than plant genes. Scientists hypothesized that the increase in A and T and the presence of certain sequences in the bacterial Bt gene might be the cause of low Bt expression in plants. Who made this discovery, when it was made and how this discovery was used to design an insecticidal Bt gene are all key parts of this case. D. The Court’s May 20, 1998 Claim Construction Hearing 1. Overview of Claim Construction Issues On May 20,1998, the court held its claim construction hearing. The parties submitted pre- and post-hearing briefs. At the hearing, the court heard further argument from the parties, as well as the testimony of three experts, Dr. Nam-Hai Chua, Dr. Julia Bailey-Serres, and Dr. Joseph Fal-kinham, III. The parties dispute the meaning of only one phrase of the claims at issue. Specifically, Claims 7, 8, 9 and 12 of the ’365 patent all refer to a “modified chimeric gene.” There are two methods for altering gene sequences to make a modified chimeric gene. The first method, known as site-directed mutagenesis, is the process of designing a gene by substituting one or more nucleotides at predetermined sites in a natural gene. The second method, known as chemical synthesis, is the process of creating synthetic DNA by chemically linking nucleotides in the proper sequence to produce the desired DNA sequence. The synthetic DNA is then incorporated into the native gene to alter the sequence. Defendants argue that a “modified chimeric gene” includes only genes made by site-directed mutagenesis. Monsanto argues that a “modified chimeric gene” is a gene made by either method. At the conclusion of the claim construction hearing, the court determined that a “modified chimeric gene,” as used in the ’365 patent, includes a gene designed by either site-directed mutagenesis or chemical synthesis. The court explains its reasoning below. 2. Hearing Testimony of Expert Witnesses Dr. Nam-Hai Chua, a professor at Rockefeller University and the head of its plant molecular biology laboratory, testified for Monsanto. According to Chua, site-directed mutagenesis is a method for altering DNA sequences at specific locations on a gene. He testified that one would use site-directed mutagenesis to make changes in discrete areas in a gene. According to Chua, chemical synthesis is a process where pieces of synthetic DNA are made and then incorporated into the native gene to alter the DNA sequence. Chua testified that one would use chemical synthesis to make changes in a large number of areas in the gene. Chua testified that there is no difference between genes designed by site-directed mutagenesis and those designed by chemical synthesis, so long as the sequences changed by the different methods are identical. He further testified that the subject matter of the ’365 patent concerns increasing Bt expression in plants, and that nothing in the patent is process-specific. According to Chua, the word “modified” in the ’365 patent means “changes in the DNA sequence that are different from the native Bt sequence.” Dr. Julia Bailey-Serres, an associate professor of genetics specializing in plant gene expression at the University of California at Riverside, testified for Novartis. According to Bailey-Serres, site-directed mutagenesis involves synthesizing a short DNA sequence that differs from the native gene sequence in only a few nucleotides. The synthetic DNA is then hybridized, or bound, with native DNA, then enzymatically copied to produce a DNA sequence which is altered in a small, discrete region. She testified that chemical synthesis involves the insertion of a large piece of synthetic DNA into the native gene. This procedure alters large sections of the DNA sequence. Bailey-Serres testified that the ’365 patent claims an invention in which specific gene sequences are altered by site-directed mutagenesis. Dr. Joseph Falkinham, III, a professor of microbiology and genetics at Virginia Polytechnic Institute, testified for Myco-gen. He agreed with Bailey-Serres’s testimony about the differences between the two methods. Falkinham testified that the term “modified chimeric gene” refers to a gene designed by site-directed mutagenes-is. 3. The Prosecution History Of The ’365 Patent On February 24, 1989, Monsanto filed U.S. Patent Application Serial No. 315,355 (“the ’355 application”) with the Patent and Trademark Office (“PTO”), naming David A. Fischhoff and Frederick J. Perlak as the inventors. This application, entitled “Synthetic Plant Genes And Method For Preparation,” disclosed several different Bt genes, including genes with changes in a specific region referred to as the “240 region” or “B region.” The so-called 240 region of a native Bt gene is a region of 36 nucleotides beginning at the positions indicated below: TTAATTAACCAAAGAATAGAAGAATTCGCTAGGAAC 1 5 10 15 20 25 30 35 Monsanto scientists learned that while Bt genes consist of approximately 62% A and T nucleotides, most plant and other bacterial genes consist of only 45% to 55% A and T nucleotides. Thus, Monsanto scientists discovered that by replacing certain A and T nucleotides with G and C nucleotides, the Bt gene became more plant-like. Throughout the prosecution history of the ’355 application, Monsanto often referred to ATTTA sequences and polyade-nylation sequences, which include sequences such as AATAAA, AATAAT, AACCAA, ATATAA, AATCAA and others. On February 12,1990, Monsanto filed an addendum to the ’355 application, known as a continuation in part (“CIP”). The CIP added information and examples relating to the 240 region. The CIP also-included the first use of the word “modified” in the claims. For example, Claim 30 claimed: A chimeric plant gene which comprises a structural coding sequence encoding an insecticidal protein of [Bt], said structural coding sequence being modified to reduce the number of putative polyade-nylation signals within said structural coding sequence. A chimeric gene is an engineered gene produced by combining DNA sequences from more than one organism. See, e.g., In re Vaeck, 947 F.2d 488, 490 (Fed.Cir.1991) (defining chimeric as a “[ Qhybrid) gene comprising (1) a gene derived from a bacterium of the Bacillus genus whose product is an insecticidal protein, united with (2) a DNA promoter effective for expressing the Bacilhis gene in a host cyanobacterium, so as to produce the desired insecticidal protein”). At the Mark-man hearing, Monsanto argued that in the CIP, the word “modified” is used “to reduce the number of putative polyadenylation signals, which means one could reduce either one or all of them,” and that “modified” was not used to impose a limitation on the way in which this reduction occurs. After reviewing the ’355 application, the PTO classified its claims as falling into two categories: either claims (1) “drawn to a method for improving a transformed gene in plants,” known as method claims, or (2) “drawn to a modified Bt toxin structural gene, DNA per se, and transformed plant cells,” known as gene claims. On October 1, 1991, the PTO asked Monsanto to restrict its claims to either method claims or gene claims pursuant to 35 U.S.C. § 121. This law provides that “[i]f two or more independent and distinct inventions are claimed in one application, the Commissioner may require the application to be restricted to one of the inventions.” 35 U.S.C. § 121 (1998). On October 29, 1991, Monsanto elected to restrict the claims to the second category, the modified Bt gene claims. Monsanto argued that choosing to restrict the claims to “modified Bt genes” demonstrates that the ’355 application was not claiming “the way that the gene is to be manufactured.” On February 3, 1992, the PTO rejected all claims either under § 112 for lack of adequate written description and lack of enablement, or under § 103 for obviousness. In response, on April 22, 1992, Monsanto filed an amendment to the claims. Monsanto made several changes to the claims including adding the word “modified” before “structural gene” in certain claims. For example, Claim 13, as amended, read: A modified structural gene which encodes an insecticidal protein of Bacillus thuringiensis, wherein a naturally occurring structural gene of Bacillus thur-ingiensis has been modified to remove a sufficient number of polyadenylation signals and ATTTA sequences so as to increase expression of said protein in a plant cell. . In response to the PTO’s § 112 objection, Monsanto argued that “[t]he application enables anyone of ordinary skill in the art to modify any DNA sequence from any Bt strain from its naturally occurring sequence so as to remove polyadenylation signals and ATTTA sequences.” Monsanto also argued that the “present claims are reasonably crafted to include the subject matter to which applicants regard as their invention and to which they are entitled, which is a modified structural gene and a plant containing the claimed modified structural gene.” In response to the PTO’s § 103 objection, Monsanto distinguished its invention from the prior art by stating that “none of the references relied upon by the examiner suggests or discloses ATTTA sequences and none of the references provides any suggestion or disclosure of replacing ATT-TA or polyadenylation sequences in a structural gene to increase expression of a gene or that these sequences have any effect on the expression of a gene in any cell.” On July 13, 1992, the PTO rejected all claims. The PTO rejected some of the amended claims under 35 U.S.C. § 132 because the amended claims added new matter into the specification. The PTO rejected the remaining claims under either § 112 or § 103. On October 9, 1992, Monsanto filed a continuation application, U.S. Application Serial No. 959,506, from which the ’365 patent eventually issued. In the continuation application, Monsanto argued that “the claims have been amended so as to only encompass modified chimeric genes and not encompass naturally occurring structural coding sequences in which the claimed modifications have not been made.” In the continuation application, Monsanto argued that it had developed “a method for modifying the structural' coding sequence which codes for the proteins from Bt to increase the expression of a chimeric gene containing that structural coding sequence in plant cells.” Monsanto further argued that the “application enables anyone of ordinary skill in the art to modify any DNA sequence from any Bt strain from its naturally occurring sequence so as to remove polyadenylation signals and ATTTA sequences.” At the claim construction hearing, Monsanto argued that this clarification of the claims shows that the word “modified” has no particular significance related to the method of how the gene is made. In the continuation application, Monsanto also argued that “[t]he claimed invention is not rendering the structural coding sequences ‘plant preferred.’ Indeed, some of these changes can result in changing to a less preferred codon for a particular amino acid.” At the hearing, defendants argued that this statement shows that Monsanto “surrendered during the prosecution the subject matter of the synthetic gene made by plant preferred codons.” On June 1, 1993, the PTO again rejected the claims under either § 112 or § 103. On October 4, 1993, Monsanto filed an amendment to clarify the term “modified.” Monsanto noted: The issue discussed in the earlier Office Action and discussed in the interview was that the claims may encompass Bt toxin proteins that may naturally not have to be modified (i.e., may not meet any of the criteria set forth in the claims where change would be required). The claims have been amended so as to only encompass modified chimeric genes and not encompass naturally occurring structural coding sequences in which the claimed modifications have not been made. In the amendment, Monsanto also stated that “[i]n the invention as claimed, only [the] structural coding sequence is modified to increase the expression of the chimeric gene.” Additionally, “[t]he claimed invention is directed to changes in the structural coding sequence and not in non-coding regions.” Monsanto wrote that the claimed invention uses “a method ■ which involves modifying some, but not all, ATT-TA sequences and polyadenylation sequences.” On January 25, 1994, the PTO again rejected all claims. On May 25, 1994, Monsanto again amended the claims to “rewrite the claims to be in product format, rather than product-by-process format,” and to clarify the language in the claims. In particular, Monsanto amended Claim 43, which became Claim 1 of the ’365 patent, to state that the Bt gene structural coding sequence has “a DNA sequence which differs from the naturally occurring DNA sequence encoding said Bacillus thuringien-sis protein.” On September 9, 1994, the PTO announced the allowability of some of Monsanto’s claims, and finally rejected the remaining claims. The PTO explained: Again, the claims, as written, read upon almost any (silent) alteration to the coding sequence of the gene, either recombinant or chemical, etc. The claims are not within the enablement of the specification, as they do not provide one of ordinary skill in the art with a mode of ‘modification’ of the gene. There is no basis given for one of ordinary skill in the art to determine what amount would constitute as an ‘increase’ in expression. Furthermore, the PTO concluded that “the claims are not even limited to the recombinant replacement of the target sites in the genes.” On October 12, 1994, Monsanto canceled the rejected claims. On November 1,1994, the PTO suspended prosecution of the pending claims for six months, explaining that “[a] reference relevant to the examination of [Monsanto’s] application may soon become available.” This reference was U.S. Patent No. 5,380,831 (“the ’831 patent”), which the PTO issued to Mycogen’s predecessor on January 10, 1995. The ’831 patent named Michael J. Adang as one of the inventors. The ’831 patent discloses a method for creating “[s]ynthetic [Bt] toxin genes designed to be expressed in plants at a level higher than naturally-occurring Bt genes are provided.” A synthetic Bt gene is a gene created by chemical synthesis. On March 7, 1995, the PTO withdrew its previous allowance of the claims pending in the ’355 application, and rejected all claims “in view of the newly discovered prior art to Adang et al, U.S. Patent 5,380,831.” The PTO wrote that “[t]he references teach several points regarding the problems of expression in plants due to the A+T sequence-rich regions causing polyadenylation and/or splicing in the co-don regions, and Adang et al. (’831) provide a successful and demonstrated means to solve the problem.” Furthermore, the PTO stated that the prior art “provided one of ordinary skill in the art with the necessary information to delete and/or replace codons that were detrimental to the heterologous Bt gene expression in plants.” On April 26, 1995, Monsanto filed another continuation application. Monsanto distinguished its invention from the ’831 patent by emphasizing that Monsanto’s invention focused on making changes in the 240 region. Monsanto argued that its invention was “directed to the discovery that when one eliminates certain sequences and when one increases plant preferred codons, that some changes are more important than others and that certain locations in the Bt gene are more important to change to achieve Bt gene expression than other locations.” Monsanto compared this to the ’831 patent which “does not distinguish any region of the Bt gene from any other region of the Bt gene.” Additionally, Monsanto noted that specific claims “are directed to the discovery by application of a result effective region of Bt genes that when modified to remove the occurrence of certain sequences, can improve the expression of the Bt gene in plant cells dramatically.” Monsanto also argued that “[w]hile Claims 43, 44 and 51 are open to changes in other regions, they require changes in the [240] region, which has been shown to be more result effective than any other region.” Claim 43 became Claim 1 of the ’365 patent. On October 4, 1995, the PTO finally rejected all claims under § 112 and § 103, explaining that “[t]he combination of teachings of the prior art, either generally or specifically, set forth the ideas of the instant invention.” Additionally, the PTO noted that “[t]he instantly disclosed ‘[240] region,’ as well as others, aré encompassed by the teachings of the prior art,” and the “fact that some regions in the sequence respond better than others is still regarded as encompassed by the teachings of the prior art.” On October 24, 1995, Monsanto filed an amendment to the ’355 application. Monsanto stated that “[t]he pending claims are limited to that subset of modified Bt genes that at least have modifications in a particular region, which has been referred to in the previous response as the ‘B region’ or ’240 region’ and plant cells that contain a modified Bt gene that has modifications in the ‘B region’ or in the ’240 region.’ ” In the amendment, Monsanto emphasized the differences between its claimed invention and the prior art. Monsanto argued that “[n]one of the cited art, other than [the ’831 patent], discusses modifying the structural coding sequences of Bt genes for the purpose of improving the expression of those structural coding sequences in plant cells.” Additionally, while not agreeing with the PTO’s characterization of the ’831 patent as prior art, Monsanto noted that the ’831 patent “only generally describes modifications and does not render obvious the claimed invention.” Comparing its invention with the prior art, Monsanto stated that its “claimed invention ... requires that those Bt genes that contain the ‘B’ or ’240’ region must have certain modifications in at least that region.” Monsanto described the claimed invention as “directed to a chimeric gene modified in a particular region.” Monsanto noted: None of the cited art provides an example of a Bt gene containing a modified “B” [240] region. None identifies the “B” [240] region for any purpose. None of the cited art discloses that one skilled in the art should modify any region or that modifications in one region are more result effective than any other region. None of the cited art discloses modifying a Bt gene to remove the occurrence of sequences that occur in the “B” region, ia, AATTAA or AACCAA sequences. Co-inventor Fischhoff filed a declaration with the amendment, in which he declared that the ’831 patent “has only one. example of a synthetic Bt gene, a Btt gene shown in Figure 1. This gene does not contain a ‘B’ or ’240’ region.” Btt refers to Bacillus thuringiensis var. tenebrionis. On November 14, 1995, the PTO announced that the claims in the ’355 application were ready for allowance. On December 13, 1995, a Monsanto attorney filed a request for early issuance on the basis that the “claims are being infringed upon.” 4. The ’865 Patent The PTO issued the ’365 patent on March 19, 1996. The patent, entitled “Synthetic Plant Genes,” discloses- a “method for modifying structural gene sequences to enhance the expression of the protein product” and “novel structural genes which encode insecticidal [Bt] proteins.” The ’365 patent discloses a method to increase production of Bt toxin by replacing Bt gene sequences believed to reduce Bt expression in plants with sequences believed to enhance Bt expression in plants. The invention results in insect-resistant plants. The “Statement of the Invention,” found at column 7, lines 32-35 of the patent’s specification, reads: “[t]he present invention provides a method for preparing synthetic plant genes which genes express their protein product at levels significantly higher than the wild-type genes.” At column 10, lines 1-13,- the patent’s specification describes the invention: In its most rigorous application, the method of the present invention involves the modification of an existing structural coding sequence (“structural gene”) which codes for a particular protein by removal of ATTTA sequences and putative polyadenylation signals by site-directed mutagenesis of the DNA comprising the structural gene. It is most preferred that substantially all the po-lyadenylation signals and ATTTA sequences are removed although enhanced expression levels are observed with only partial removal of either of the above identified sequences. Alternately if a synthetic gene is prepared which codes for the expression of the subject protein, codons are selected to avoid the ATTTA sequence and putative polyadenylation signals. The patent’s specification, describing a figure accompanying the text, notes that “[a]nother embodiment of the present invention, represented in the flow diagram of Figure 1, employs a method for the modification of an existing structural gene or alternately the de novo synthesis of a structural gene which method is somewhat less rigorous than the method first described above.” See column 10, lines 22-27. At column 12, lines 30-34, the specification states that it should be clear to those skilled in the art that “while the above description [of regions with ‘many consecutive A+T bases or G+C bases’] is directed toward the modification of the DNA sequences of wild-type genes, the present method can be used to construct a completely synthetic gene for a given amino acid sequence.” Additionally, the patent’s specification states that the DNA construct of the invention contains “a modified or fully-synthetic structural coding sequence which has been changed to enhance the performance of the gene in plants. In a particular embodiment of the present invention the enhancement method has been applied to design modified and fully synthetic genes, encoding the crystal toxin protein of [Bf].” Column 13, lines 49-55. The ’365 patent consists of twelve claims. Claims 7, 8, 9 and 12 are the four asserted claims at issue in this case. Claim 7 is independent and reads: A modified chimeric gene comprising a promoter which functions in plant cells operably linked to a structural coding sequence and a 3' non-translated region comprising a polyadenylation signal which functions in plants to cause the addition .of polyadenylate nucleotides to the 3' end of the RNA, wherein said structural coding sequence encodes a toxin protein derived from a Bacillus thuringiensis protein, wherein said structural coding sequence comprises a DNA sequence which differs from the naturally occurring DNA sequence encoding said Bacillus thuringiensis protein and comprises the following characteristics: said naturally occurring DNA sequence comprises a region having the following sequence: TTAATTAACCAAAGAATAGAAGAATTCGCTAGGAAC 1 5 10 15 20 25 30 35 and where said structural coding sequence comprises modifications so that at least said region contains at least one fewer sequence selected from the group consisting of an AACCAA and an AAT-TAA sequence. Claim 8 depends from Claim 7 and claims “[t]he modified chimeric gene of claim 7 wherein said modifications increase the number of plant preferred codons in said structural coding sequence.” Claim 9 also depends from Claim 7 and claims “[t]he modified chimeric gene of Claim 7 wherein said Bacillus thuringiensis is Bacillus thuringiensis var. kurstaki.” Claim 12 is independent and reads: A transformed plant cell comprising a modified chimeric gene which comprises a promoter which functions in plant cells operably linked to a structural coding sequence and a 3' non-translated region comprising a polyadenylation signal which functions in plants to cause the addition of polyadenylate nucleotides to the 3' end of the RNA, wherein said structural coding sequence encodes a toxin protein derived from a Bacillus thuringiensis protein, wherein said structural coding sequence comprises a DNA sequence which differs from the naturally occurring DNA sequence encoding said Bacillus thuringiensis protein and has characteristics comprising the following: said naturally occurring DNA sequence comprises a region having the following sequence: TTAATTAACCAAAGAATAGAAGAATTCGCTAGGAAC 1 5 10 15 20 25 30 35 and wherein said structural coding sequence comprises modifications so that at least said region contains at least one fewer sequence selected from the group consisting of an AACCAA and an AAT-TAA sequence. 5. What is the Legal Standard for the Court’s Claim Construction? The court construes claims according to their “ordinary and accustomed meaning,” see Renishaw PLC v. Marposs Societa’ per Azioni, 158 F.3d 1243, 1249 (Fed.Cir.1998), and from the vantage point of a person of ordinary skill in the art at the time of the invention. See Markman v. Westview Instruments, Inc., 52 F.3d 967, 986 (Fed.Cir.1995) (en banc), aff'd, 517 U.S. 370, 116 S.Ct. 1384, 134 L.Ed.2d 577 (1996). In construing a claim, a court looks first to the intrinsic evidence of record, namely, the language of the claim, the specification, and the prosecution history. Insituform Tech. Inc. v. Cat Contracting, Inc., 99 F.3d 1098, 1105 (Fed.Cir.1996), cert. denied, 520 U.S. 1198, 117 S.Ct. 1555, 137 L.Ed.2d 703 (1997). The claim language itself defines the scope of the claim. However, the court may interpret a term in a patent claim to have a meaning other than the one a person of ordinary skill in the art would give it if it is apparent from the patent and the prosecution history that the inventor intended a different meaning. See Hoechst Celanese Corp. v. BP Chems. Ltd., 78 F.3d 1575, 1579 (Fed.Cir.), cert. denied, 519 U.S. 911, 117 S.Ct. 275, 136 L.Ed.2d 198 (1996). The court may consider expert testimony if needed to assist it in understanding the meaning or scope of technical terms in a claim. See Hoechst, 78 F.3d at 1579. However, the court should not rely on any extrinsic evidence where the claims, specification, and file history unambiguously define the scope of the claim. See Vitronics Corp. v. Conceptronic, Inc., 90 F.3d 1576, 1583 (Fed.Cir.1996); see also Pitney Bowes, Inc. v. Hewlett-Packard Co., 182 F.3d 1298, 1307 (Fed.Cir.1999). Although the Court of Appeals for the Federal Circuit has held that claims should be read in light of the specification, Vitron-ics Corp. at 1582, the court has repeatedly cautioned against limiting the scope of a claim to the preferred embodiment or specific examples disclosed in the specification. See e.g., Ekchian v. Home Depot, Inc., 104 F.3d 1299, 1303 (Fed.Cir.1997); Intervet America, Inc. v. Kee-Vet Laboratories, Inc., 887 F.2d 1050, 1053 (Fed.Cir.1989) (explaining that it is “improper” to read an extraneous limitation from the specification into the claim). 6. How Does the Court Construe the Term at Issue, “Modified"? Claims 7, 8, 9 and 12 all refer to a “modified chimeric gene.” Monsanto argues that “modified” (as well as variations of the word, including “modify” and “modification”) means changes to the naturally occurring gene sequence, whether by site-directed mutagenesis or by chemical synthesis. Defendants argue that “modified” only includes changes by site-directed mu-tagenesis. The patent does not specifically define the method by which structural gene sequences are modified. The specification discusses genes designed by chemical synthesis. For example, at column 6, lines 30 to 33, the patent’s specification explains that “it is an object of the present invention to provide a method for preparing synthetic plant genes which express their respective proteins at relatively high levels when compared to wild-type genes.” The specification also discusses genes designed by site-directed mutagenesis. For example, at column 10, lines 1-6, the specification states that “[i]n its most rigorous application, the method of the present invention involves the modification of an existing structural coding sequence (‘structural gene’) which codes for a particular protein by removal of ATTTA sequences and putative polyadenylation signals by site-directed mutagenesis of the DNA comprising the structural gene.” The specification discusses both site-directed mutagenesis and chemical synthesis. For example, an entire section of the specification, entitled “Synthetic Oligonu-cleotides For Mutagenesis,” discusses how the “oligonucleotides used in the mutagen-esis are designed to maintain the proper amino acid sequence” in the “modified gene.” This section concludes by explaining that “[i]t is evident to those, skilled in the art that while the above description is directed toward the modification of the DNA sequences of wild-type genes, the present method can be used to construct a completely synthetic gene for a given amino acid sequence.” Column 12, lines 30 to 34. Similarly, Table III of the specification “lists the synthetic oligonucleotides designed and synthesized for the site-directed mutagenesis of [a specific Bt ] gene.” And the specification discusses “hybrid genes, part wild-type, part synthetic, [which] were generated to determine the effects of synthetic gene segments on the levels of B.t.k. expression.” Column 18, lines 62 to 67. These portions of the specification demonstrate that a synthetic gene can be designed by chemical synthesis, or a synthetic gene sequence can be designed and inserted into predetermined sites in a native gene by site-directed mutagenesis. As explained throughout the specification, the ’365 patent encompasses genes that are partially synthetic in a specific region and genes that are synthetic throughout the entire gene. Thus, from reading the specification, the court determines that “modified” refers to genes with changes by either site-directed mutagenesis or by chemical synthesis. The court finds that the prosecution history of the ’365 patent provides further support for this determination. From the beginning of the prosecution of the ’355 application, Monsanto focused on making changes to the 240 region of the gene. For example, responding to the PTO’s request that Monsanto restrict its claims to either method claims or gene claims, Monsanto decided not to claim the process for designing the genes, whether by site-directed mutagenesis or by chemical synthesis. Rather, Monsanto claimed genes with changes in the 240 region,' regardless of the process involved in designing the genes. As the prosecution history demonstrates, Monsanto continually distinguished its claimed invention from the pri- or art on the grounds that its invention identified the 240 region as the “result effective” or key region. Notably, Monsanto did not distinguish its invention on the grounds that the prior art claimed genes designed by chemical synthesis, as opposed to genes designed by site-directed mutagenesis. For example, after the PTO suspended prosecution of the ’355 application when it issued the ’831 patent, Monsanto filed a declaration from Fischhoff. In this decía-ration, Fischhoff distinguished the invention from the ’831 patent on the basis that the ’831 patent did not specify the 240 region, not on the basis of whether the gene was created by site-directed muta-genesis or chemical synthesis. The PTO recognized that Monsanto was not focusing on the specific process for making changes to the 240 region. For example, on September 9, 1994, the PTO noted that the “claims are directed to a gene, and not a method of increasing expression or a host organism, etc.” Similarly, the PTO remarked that “[a]gain, the claims, as written, read upon almost any (silent) alteration to the coding sequence of the gene, either recombinant or chemical, etc.” The PTO further stated that “the claims are not even limited to the recombinant replacement of the target sites in the genes.” Thus, as both the specification and the prosecution history demonstrate, the ’365 patent does not impose any limitation on the process by which a gene is designed to enhance Bt expression. Rather, the ’365 patent encompasses genes designed by both methods: site-directed mutagenesis and chemical synthesis. Furthermore, the ’365 patent and the prosecution history demonstrate that the only limitation imposed by the claimed invention is that the native Bt gene is changed, regardless of the manner in which the change occurs. Claims 7 and 12 of the ’365 patent refer to a “modified chimeric gene” with a structural coding sequence which “comprises a DNA sequence which differs from the naturally occurring DNA sequence.” Additionally, the claims refer to the 240 region as the “naturally occurring DNA sequence” in which “modifications” are made so that “at least said region contains at least one fewer sequence selected from the group consisting of an AACCAA and an AATTAA sequence.” Thus, it appears from “the ordinary and accustomed meaning of claim terms” that the word “modified” is used to draw a distinction between a gene that has alterations to the 240 region and a gene that is naturally occurring. See, e.g., Johnson Worldwide Associates, Inc. v. Zebco Corp., 175 F.3d 985, 989 (Fed.Cir.1999) (“[A] court must presume that the terms in the claim mean what they say, and, unless otherwise compelled, give full effect to the ordinary and accustomed meaning of claim terms.”). Additionally, throughout the prosecution history, Monsanto explained that the claimed invention “enables one of ordinary skill in the art to modify any DNA sequence from any Bt strain from its naturally occurring sequence so as to remove polyadenylation signals and ATTTA sequences.” Monsanto did not use language that would limit these modifications to only those made by site-directed mutagenesis. Accordingly, the court concludes that the word “modified,” and variations of the word, including “modify” and “modification,” means altered or changed from the naturally occurring gene sequence, irrespective of the manner in which the changes are made. Thus, a “modified chimeric gene,” as used in the ’365 patent, includes a gene designed by either site-directed mutagenesis or a gene designed by chemical synthesis, with changes in the 240 region. E. The Jury Trial 1. Monsanto’s Case-in-Chief At trial, Monsanto set out to prove that Mycogen and Novartis are infringing the ’365 patent by selling insect-resistant corn seeds. According to Monsanto, these seeds have incorporated into their genetic material the modified Bt gene that enables the corn to manufacture pesticidal proteins. This is the same modified Bt gene that the ’365 patent discloses. Monsanto argued that Perlak and Fisch-hoff were the first to invent the modified Bt gene that works so successfully in the defendants’ infringing corn products. Per-lak and Fischhoff made this invention after much experimentation involving different scientific approaches. In 1986, they devised a strategy that they implemented the following year. An integral part of this strategy included identification of the Bt gene’s 240 region as the “result effective” portion of the nucleotide sequence where certain nucleotide changes can bring about great increases in pesticidal protein production. By the summer of 1988, test results confirmed that Fischhoff and Per-lak had built a synthetic Bt gene that produced pesticidal proteins in transformed plants. As its first witness, Monsanto called Dr. Stephen G. Rogers, a Monsanto scientist specializing in plant genetics. According to Rogers, at the time he joined Monsanto in 1980, the scientific community had not been able to “transform” plants, which he defined as introducing a foreign gene into a plant so that the introduced trait is passed on to subsequent generations of the plant, a process known as “inheritan-cy.” Rogers testified that Monsanto successfully transformed plants in the fall of 1982, and announced its work publicly in January 1983. In April 1983, Monsanto scientists published a paper on their transformation work. See Fraley et al., “Expression of Bacterial Genes in Plant Cells,” in Proc. Nat’l AcaÁ. Sci. USA 80:4803-4807 (1983). By 1984, Monsanto scientists demonstrated that the genes of the transformed plants achieved inheritan-cy- Rogers testified at length about genes. According to Rogers, all genes have a promoter, a structural coding sequence and a 3’ non-translated end. The promoter controls how many copies of RNA are made; the structural coding sequence controls which proteins are made; and the 3’ non-translated end is the last part of a gene. Referring to a Monsanto document, Rogers testified that on February 15,1984, he and his colleagues produced a confidential paper entitled, “Codon Usage by Nuclear Plant Genes.” This paper included a codon usage table. He testified that scientists use codon usage tables to determine the frequency with which certain codons appear in plants and other organisms. For example, the abstract from this paper states that “genes from dicotyledonous plants [dicots] seldom use the codon families CGX, XCG and XUA.” Rogers testified that Monsanto scientists, including Fischhoff and Perlak, began working on inserting Bt into plants as early as 1983. According to Rogers, their fust attempts involved taking the entire coding sequence for the native Bt protein, inserting it into vectors and transporting the coding sequence into plant cells. Vectors are DNA molecules used to carry or shuttle the gene into the plant. See, e.g., Ajinomoto Co. Inc. v. Archer-Daniels-Midland Co., 1996 WL 621837, *6 (D.Del. Oct.21, 1996). Rogers testified that Monsanto scientists succeeded in vectoring the entire coding sequence of native Bt into plants like tomato and tobacco. They discovered, however, that these genetically-modified plants did not produce enough Bt pesticidal protein. The level of expression of the native Bt genes inserted into the plants was too low. Rogers testified that after studying these results, Monsanto scientists realized they did not need to insert into the plant the entire coding sequence of the native Bt protein to get the levels of expression they desired. Hence, they made truncated genes and shuttled these genes into plants, using vectors. Rogers testified that expression was a little better with these transformed plants compared to plants transformed with the entire coding sequence of the native Bt protein. However, the level of expression of the truncated genes was still too low to be commercially viable. According to Rogers, by 1986, Fischhoff became Monsanto’s lead scientist responsible for “solving [the] Bt problem.” Fisch-hoff reported directly to Rogers. Rogers testified that in September or October 1986, he and Fischhoff met to review data. They concluded that the transformed plants with the truncated genes had very-little RNA. Since RNA is needed to make protein, they reasoned that the lack of RNA explained the low expression of Bt protein. Rogers referred to a two-page Monsanto memorandum, dated October 30, 1986. He testified that Fischhoff prepared this memorandum at his request as a summary of what they discussed at their meeting and what their research plans were. Rogers testified that the October 30, 1986 memorandum identifies AT-rich regions in the Bt coding sequence as a cause of RNA instability in plant cells because the plant misinterprets the AT-rich regions. According to Rogers, Monsanto scientists considered two approaches to solve the problem of low Bt expression in plants. One approach involved site-directed mu-tagenesis to identify and modify the most problematic AT-rich regions of the coding sequence. He testified that the second approach involved chemical synthesis which changes all of the coding sequence to create a synthetic gene. Rogers testified that chemical synthesis is a much broader approach requiring more resources than site-directed mutagenesis. Rogers testified that regardless of which process is used to make a new gene, the new gene operates in the same way: “In the end you have a DNA that has changes in it.” Rogers testified that the memorandum lists several possible causes of RNA instability including: (1) specific signals for RNA degradation;, (2) signals for improper polyadenylation of the RNA; (3) premature termination of transcription; and (4) signals for improper splicing of the RNA. Rogers testified about a December 19, 1986 memorandum he wrote. He testified that the memorandum indicates that Fischhoff and Perlak planned to start doing site-directed mutagenesis in 1987 for the purpose of changing specific regions of the DNA coding sequence to increase Bt protein expression. He also referred to 'a memorandum prepared by Fischhoff outlining goals for 1987 to show that one of the scientists’ goals in 1987 included maximizing stable expression of chimeric Bt toxin genes. According to the memorandum, Monsanto’s scientists set a specific goal of constructing a modified Btk toxin gene to show a ten-fold increase in insect resistance. Rogers testified that the synthetic Btk genes they constructed achieved a one hundred- to five hundred-fold increase in insect resistance. Rogers testified that Fischhoff and Per-lak reported to him throughout 1988. He testified that his, responsibilities included preparing governmental regulatory-related work and drafting field test applications for Bt plants. According to Rogers, genetically-modified insect-resistant plants required approvals from several government agencies including the U.S. Department of Agriculture, the Food and Drug Administration and the Environmental Protection Agency. Rogers testified that the required regulatory submissions for Monsanto’s Bt corn were made in “about 1995.” On cross-examination, Rogers testified that neither his December 19, 1986 memorandum nor Fischhoffs memorandum discussing goals specified the exact coding sequences Fischhoff would put into his synthetic gene. Similarly, Rogers testified that while these documents indicate that the modified gene would include fewer po-lyadenylation sequences, they did not provide information that would enable him to predict which would be the most important polyadenylation sequences to remove. According to Rogers, at about the same time Monsanto announced it had successfully transformed plants in 1983, two other scientists, Mary-Dell Chilton and Jeff Schell, made similar announcements. Rogers testified that Chilton, a former Monsanto consultant, provided strains and plasmids for Monsanto’s work. Plasmids are small circular pieces of DNA found in bacteria, separate from genomic DNA, which are capable of replication. Unlike plants and animals, bacteria lack chromosomes; instead, they have one large circle of DNA containing all the genes, and smaller circles of plasmid DNA. Plasmids are a convenient tool for molecular biologists because their small size makes them easy to manipulate. Sh